Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_101889/hsa_circ_0040705 | |||
Gene | USP10 | Organism | Human |
Genome Locus | chr16:84792321-84801964:+ | Build | hg19 |
Disease | Systemic Lupus Erythematosus | ICD-10 | Drug-induced systemic lupus erythematosus (M32) |
DBLink | Link to database | PMID | 29360436 |
Experimental Method | |||
Sample Type | Blood samples | Comparison | 48 paired plasma samples including twenty-four Systemic Lupus Erythematosus (SLE) patients and 24 normal volunteers |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward ACAAGATACGCACAGTCCAGGAT ReverseTGTAGCACCAGTTCCCTTTATTGA | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Li, H, Li, K, Lai, W, Li, X, Wang, H, Yang, J, Chu, S, Wang, H, Kang, C, Qiu, Y (2018). Comprehensive circular RNA profiles in plasma reveals that circular RNAs can be used as novel biomarkers for systemic lupus erythematosus. Clin. Chim. Acta, 480:17-25. |